Human lactoferrin modulates gene expression of the cytokine IL4 and the receptor TLR4 in the rat spleen under stress and upon the lipopolysaccharide administration

ABSTRACT

Lactoferrin is a multifunctional glycoprotein of the transferrin family with a molecular mass of about 80 kDa. We studied the effect of human lactoferrin on stress- and lipopolysaccharide-induced changes in blood corticosterone levels, as well as on the gene expression of the cytokine IL4 and the pattern-recognition receptor TLR4 in rat splenocytes. Stress in rats was modeled by swimming in cold water (1-4°C) for 2 min. Lactoferrin and lipopolysaccharide (LPS) were administered intraperitoneally before the stress exposure. Corticosterone level in the plasma was determined by enzyme immunoassay, and changes in gene expression were assessed by real-time polymerase chain reaction (PCR) with reverse transcription. We showed that preventive intraperitoneal administration of lactoferrin reduced the stress and LPS-induced increase in the gene expression of both IL4 and TLR4 in rat splenocytes but did not change the concentration of corticosterone in the blood.

Main article text

INTRODUCTION

The most common causes of changes in the immune response are stress factors that lead to redistributive reactions of blood leukocytes, changes in hormonal levels, and cytokine production. These can be factors of an infectious nature as well as different variations of physical or emotional stress. Even though neutrophilia is one of the classic manifestations of the stress response, the biological meaning of this phenomenon remains unclear. Research is carried out mainly in the direction of studying stress-induced changes in the functional activity of these cells [1,2]. However, we can assume that antimicrobial proteins that are secreted from neutrophils, particularly lactoferrin (LF), not only act as antibiotics but also can influence the development of stress and immune responses according to the principles of regulation of physiological reactions.

Experimental models simulating some aspects of the infectious process, such as inducing the changes in cytokine production by means of LPS administration, are often used to evaluate the immunomodulatory properties of lactoferrin. With the help of such models, it was shown that LF can inhibit the LPS-induced increase in TNFα, IL1β, and IL8 secretion by the human monocyte cell line THP-1 [3]. Experiments on mice have also demonstrated that LF has a protective effect against LPS-induced intestinal inflammatory injury [4]. The effect of stress on this aspect of the immunomodulatory action of LF has not been previously studied, although the combination of stress and infection is a reallife situation.

Previously, we found that LF exhibits stress-protective and immunomodulatory effects in an experimental model that combined emotional and physical stress in rats. Thus, it was shown that preventive LF administration significantly diminishes the stress-induced increase in both corticosterone concentration in the blood (observed 30 min after stress exposure) [5] and the Tlr4 gene expression in rat splenocytes (observed 3 h after stress exposure) [6].

In this study, we investigated the effect of LF on corticosterone level and on the expression of the IL4 cytokine gene and the TLR4 pattern-recognition receptor gene under stress and upon LPS administration in rats.

MATERIALS AND METHODS

Animals

Experiments were performed in male Wistar rats weighing 150-200 g. The animals were kept under vivarium conditions at room temperature with a 12-h light/dark cycle and free access to water and food (the standard diet in accordance with the current requirements for keeping laboratory animals (European Convention for the Protection of Vertebrate Animals Used for Experimental and Other Scientific Purposes, https://rm.coe.int/168007a67b).

Reagents

Human milk lactoferrin (purity ≥ 98%, iron saturation 10-15%) was isolated by ion exchange chromatography and gel filtration according to the method described earlier [7]; LPS from E. coli serotype 055: B5 (Sigma, USA) was used.

Protein samples were evaluated for the presence of LPS using the Limulus test (quantitative chromogenic Limulus amebocyte lysate (LAL); Lonza Walkersvile, USA). Incubation with polymyxin-agarose (Sigma, USA) was used to remove LPS contamination. The final concentration of LPS in the samples did not exceed 0.2 UE/ml.

Experimental model

Swimming in cold water (1-4°C) for two minutes was used to expose rats to the combined emotional and physical stress in our experimental model. Immediately before the stress exposure, 500 μl of aqueous solutions of the studied preparations were injected intraperitoneally at the following concentrations: human LF – 200 μg/kg animal weight, LPS – 500 μg/kg animal weight. In the case of a joint test, LF (in a volume of 250 μl) was administered 5 min after the LPS injection (in a volume of 250 μl).

Blood and spleens were collected for analysis 30 min and 3 h after the end of the stress exposure. All experiments were carried out at the same time interval (11:00-14:00) in order to prevent circadian fluctuations in the corticosterone levels.

Animal groups (5-7 animals in each group): (1) intact (control 1); (2) water injection, euthanasia in 30 min after stress (control 2); (3) water injection, euthanasia in 3 h after stress (control 3); (4) LPS injection, euthanasia in 30 min after stress; (5) LPS injection, euthanasia in 3 h after stress; (6) LPS injection, stress, euthanasia in 30 min after stress; (7) LPS injection, stress, euthanasia in 3 h after stress; (8) LPS&LF injection, stress, euthanasia in 30 min after stress; (9) LPS&LF injection, stress, euthanasia in 3 h after stress.

Corticosterone determination

The determination of corticosterone concentration in blood serum was performed by enzyme immunoassay using the Corticosterone EIA-4164 kit by DRG according to the manufacturer’s instructions.

Measurement of gene expression

RNA isolation from spleen cells was performed using a commercial Gene Elute Mammalian total RNA kit (Sigma-Aldrich, USA) according to the manufacturer’s protocols.

A Bio-Rad cDNA synthesis kit (iScript cDNA Synthesis Kit, USA) was used to obtain cDNA. The procedure was performed according to the manufacturer’s protocol. The obtained cDNA was stored at -20°C.

Real-time PCR was performed using the Bio-Rad CFX96 Touch™ Real-time system. Maxima SYBR Green qPCR Master mix (2X) from Thermo Scientific was used for PCR. The glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene was used as a reference gene. Primers for PCR were selected using the Primer3 software (http://bioinfo.ut.ee/primer3-0.4.0/primer3/) and literature data [8, 9]. Primer sequences (5’-3’) were as follows: IL4 sense (CGGTGAACTGAGGAAACTCTGTAGA), IL4 antisense (TCAGTGTTGTGTGAGCGTGGACTC), TLR4 sense (CCTGAAGATCTTAAGAAGCTAT), TLR4 antisense (CCTTGTCTTCAATTGTCTCAAT), GAPDH sense (CCTGCACCACCAACTGCTTAGC), GAPDH antisense (GCCAGTGAGCTTCCCGTTCAGC).

PCR protocol: 95.0°C – 10 min; 94.0°C – 15 sec; 60.0°C – 1 min; 72.0°C – 1 sec (fluorescence reading). Steps 2-4 were repeated for 40 cycles. Melting curves were acquired using 0.5°C steps from 60.0 to 94.0°C; 10.0°C to 10 min. Reaction products were evaluated and identified by means of the melting curves method. The results were processed using the CFX Manager™ software version 2.1.

Statistical analysis

The data were statistically processed using Statistica 10.0 software. The significance of differences between the groups was assessed by one-way analysis of variance (ANOVA), followed by the post-hoc Bonferroni t-tests. The level of significance was defined as 95% (p<0.05).

RESULTS AND DISCUSSION

Without stress, gene expression of IL4 in rat splenocytes significantly increased 3 h after LPS administration compared to intact animals, while gene expression of TLR4 decreased (Fig. 1). There were no significant changes in the expression of either gene 30 min after LPS administration.

Fig. 1.

Relative Il4 and Tlr4 (versus GADPH) gene expression level in rat splenocytes 30 min and 3 h after LPS injection. All data were normalized against the numbers obtained for the group of intact animals. Animal groups: C1 – intact animals (control 1), C2 – water 30 min (control 2), C3 – water 3 h (control 3), 1 – LPS 30 min, 2 – LPS 3 h. (*) indicates p<0.05 vs all groups; (#) indicates p<0.05 vs group C1 according to the post-hoc Bonferroni t-tests.

Exposure to stress together with the LPS injection led to an increase in the expression of both studied genes 3 h after the exposure (Fig. 2).

Fig. 2.

Relative Il4 (A) and Tlr4 (B) (versus GADPH) gene expression level in rat splenocytes 30 min and 3 h after LPS injection and stress exposure. All data were normalized against the numbers obtained for the group of intact animals. Animal groups: C1 – intact animals, C2 – water 30 min, C3 – water 3 h, 1 – water + stress 30 min, 2 – water + stress 3 h, 3 – LPS + stress 30 min, 4 – LPS + stress 3 h. A. (*) indicates p<0.05 vs groups C1, C2, C3, 1, 3; (#) indicates p<0.05 vs groups C1, C2; B. (*) indicates p<0.05 vs groups C1, C2, C3, 1; (#) indicates p<0.05 vs groups C1, C2, C3, 1, 3 according to the post-hoc Bonferroni t-tests.

LF injection reduced gene expression of IL4 and TLR4 3 h after LPS injection and stress exposure (Fig. 3).

Fig. 3.

Relative Il4 (A) and Tlr4 (B) (versus GADPH) gene expression level in splenocytes 3 h after administration of lactoferrin and LPS and stress exposure. All data were normalized against the numbers obtained for the group of intact animals. Animal groups: C1 – intact animals, 1 – LPS, 2 – water + stress, 3 – LPS + stress, 4 – LPS + LF + stress. A. (*) indicates p<0.05 vs groups C1, 4; (O) indicates p<0.05 vs groups C1, 1, 4; (#) indicates p<0.05 vs groups 2, 3. B. (*) indicates p<0.05 vs groups C1, 1, 4; (#) indicates p<0.05 vs groups 2, 3 according to the post-hoc Bonferroni t-tests.

It should be noted that the administration of LF did not lead to a decrease in the elevated corticosterone blood level caused by the combined effect of stress and LPS (Fig. 4, 5).

Fig. 4.

Corticosterone level in the blood of rats 30 min after administration of lactoferrin and LPS combined with stress exposure. C1 – intact animals, 1 – LPS, 2 – water + stress, 3 – LPS + stress, 4 – LPS + LF + stress. (*) indicates p<0.05 vs C1 group according to the post-hoc Bonferroni t-tests.

Fig. 5.

Corticosterone levels in the blood of rats 3 h after administration of lactoferrin and LPS combined with stress exposure. C1 – intact, 1 – LPS, 2 – water + stress, 3 – LPS + stress, 4 – LPS + LF + stress. (*) indicates p<0.05 vs groups C1, 2; (#) indicates p<0.05 vs groups C1, 2, 3 according to the post-hoc Bonferroni t-tests.

As pointed out earlier, under conditions of combined stress exposure (swimming in cold water), preventive administration of LF reduces the stress-induced increase in blood corticosterone concentration and the Tlr4 gene expression in rat splenocytes. LF administration has the same effect on the stress-induced increase in the Il4 gene expression in splenocytes (Fig. 6).

Fig. 6.

Relative expression level of Il4 gene (versus GADPH gene) in rat splenocytes 3 h after the administration of lactoferrin and stress exposure. All data were normalized against the numbers obtained for the group of intact animals. C1 – control, C2 – water, 1 – water + stress, 2 – LF + stress. (#) indicates p<0.01 vs groups C1, C2; (*) indicates p<0.01 vs group 1 according to the post-hoc Bonferroni t-tests.

Thus, in this experiment, we have shown that LPS administration does not affect the modulating effect of LF on stress induced Il4 and Tlr4 gene expression in rat splenocytes. This modulating effect of LF on gene expression is independent of its corticostatic activity.

The mechanisms of this immunomodulatory action of LF are not yet clear. This process may involve different mechanisms. It could include central mechanisms, due to the LF ability to accumulate in brain structures like the hippocampus [10], or peripheral ones due to LF interacting with various binding sites on immune cells [11].

Acknowledgments:

This work was supported by State Contract no. 122020300189-6.

Conflict of interest:

The authors have no commercial or financial interests.

REFERENCES

1. Khanfer R, Phillips AC, Carroll D, Lord JM. Altered human neutrophil function in response to acute psychological stress. Psychosom Med 2010; 72(7), 636-40. doi: 10.1097/PSY.0b013e3181e7fae8.

2. Ellard DR, Castle PC, Mian R. The effect of a shortterm mental stressor on neutrophil activation. Int J Psychophysiol 2001; 41(1), 93-100. doi: 10.1016/s0167-8760(00)00180-x.

3. Håversen L, Ohlsson BG, Hahn-Zoric M, Hanson LA, Mattsby-Baltzer I. Lactoferrin down-regulates the LPS-induced cytokine production in monocytic cells via NF-kappa B. Cell Immunol 2002; 220(2), 83-95. doi: 10.1016/s0008-8749(03)00006-6.

4. Wu H, Fan L, Gao Y, Wang J, Zheng N. The protective effects of iron free lactoferrin on lipopoly-saccharide-induced intestinal inflammatory injury via modulating the NF-κB/PPAR signaling pathway. Foods 2022; 11(21), 3378. doi: 10.3390/foods11213378.

5. Aleshina GM, Yankelevich IA, Zhakharova ET, Kokryakov VN. Stress-protective effect of human lactoferrin. Rossiiskii fiziologicheskii zhurnal imeni I. M. Sechenova 2016; 102(7), 846-51. (In Russian).

6. Aleshina GM, Yankelevich IA, Kokryakov VN. Human lactoferrin modulates TLR4 receptor gene expression in the rat spleen under experimental stress conditions. Russian Immunological Journal 2016; 10(2), 60-2. (In Russian).

7. Zakharova ET, Shavlovski MM, Bass MG, Gridasova AA, Pulina MO, De Filippis V et al. Interaction of lactoferrin with ceruloplasmin. Arch Biochem Biophys 2000; 374(2), 222-8. doi: 10.1006/abbi.1999.1559.

8. Treacy O, Ryan AE, Heinzl T, O’Flynn L, Cregg M, Wilk M et al. Adenoviral transduction of mesenchymal stem cells: in vitro responses and in vivo immune responses after cell transplantation. PLoS One 2012; 7(8), e42662. doi: 10.1371/journal.pone.0042662.

9. Bartholomäus I, Kawakami N, Odoardi F, Schläger C, Miljkovic D, Ellwart JW et al. Effector T cell interactions with meningeal vascular structures in nascent autoimmune CNS lesions. Nature 2009; 462(7269), 94-8. doi: 10.1038/nature08478.

10. Liu Z, Jiang M, Kang T, Miao D, Gu G, Song Q et al. Lactoferrin-modified PEG-co-PCL nanoparticles for enhanced brain delivery of NAP peptide following intranasal administration. Biomaterials 2013; 34(15), 3870-81. doi: 10.1016/j.biomaterials.2013.02.003.

11. Legrand D. Lactoferrin, a key molecule in immune and inflammatory processes. Biochem Cell Biol 2012; 90(3), 252-68. doi: 10.1139/o11-056.