Antimicrobial peptides modulate lipopolysaccharide-induced gene expression of cytokines IL1β and IL10 and toll-like receptor 4 in rat blood leukocytes

Abstract

INTRODUCTION: Inflammation is a common pathological condition. On the one hand, inflammation plays a protective role, without it dangerous local processes would remain unrecognized. On the other hand, a cytokine storm can develop under conditions of systemic inflammation, which, in turn, can lead to multiple organ failure. Therefore, it is important to understand the mechanisms involved in the regulation of cytokine production in the early stages of inflammation.

OBJECTIVE: The aim of this study was to evaluate the immunomodulatory properties of human defensin (HNP-1) and porcine protegrin (PG-1) antimicrobial peptides in vivo under conditions of inflammatory process initiation.

METHODS: Lipopolysaccharide was administered intraperitoneally to laboratory rats to initiate an inflammatory response. Following the onset of inflammation, antimicrobial peptides were also administered intraperitoneally. The immunomodulatory effect of the peptides was evaluated by measuring the changes in gene expression of toll-like receptor 4 (TLR4) and cytokines IL1β and IL10 in the blood leukocytes of the animals using real-time PCR.

RESULTS: The lipopolysaccharide-induced expression of Il1b and Il10 in leukocytes, as well as the lipopolysaccharide-induced Tlr4 expression in whole blood leukocytes and isolated mononuclear cells, was reduced to varying degrees by the introduction of HNP-1 and PG-1.

CONCLUSION: It can be assumed that at the early stage of the inflammatory process, defensins can act as moderate pro-inflammatory factors, suppressing the gene expression of the anti-inflammatory cytokine IL10, but at the same time slightly reducing the gene expression of the pro-inflammatory cytokine IL1β.

Main article text

INTRODUCTION

Inflammation is a common pathological condition. On the one hand, inflammation plays a protective role; without it, dangerous local processes would remain unrecognized, injuries would end in shock, and tissue defects would not be repaired. However, tissue damage inevitably occurs during the inflammation. In particular, during a cytokine storm that may develop under conditions of systemic inflammation, cells uncontrollably produce large amounts of inflammatory mediators and pro-inflammatory cytokines, which, in turn, may lead to multiple organ failure. Therefore, it is important to understand the mechanisms involved in the regulation of cytokine production in the early stages of the inflammatory process.

One of the pathways for the activation of cytokine production involves toll-like receptors (TLRs). Components of bacterial membranes, such as lipopolysaccharide (LPS), lipoteichoic acid, and flagellin, are activators of TLR4, TLR2, and TLR5, respectively [1]. Antimicrobial peptides (AMPs) of animal origin have an increased affinity for bacterial cell wall components, and it is conceivable that by binding to LPS or lipoteichoic acid in solution, AMPs may neutralize their effects on the pattern-recognition receptors of immune cells. Human cathelicidin LL-37 and bovine indolicidin have been shown to inhibit LPS-induced tumor necrosis factor α (TNFα) production by leukocytes, such as macrophages and monocytes [2, 3]. Similarly, defensins attenuate pattern recognition receptor agonist-induced chemokine and cytokine production. Human α-defensins HNP-1 and HNP-3, as well as human β-defensins HBD1, HBD2, HBD3, and DEFB104A, reduce LPS-induced production of IL1, IL8, and intercellular adhesion molecule 1 (ICAM 1) in human monocytes of the THP-1 monocyte cell line [4]. Human β-defensins also reduce LPS-stimulated production of TNFα in mouse macrophages of RAW264.7 cell line [5] and reduce the level of TNFα in the blood serum of mice after intraperitoneal administration of LPS [6].

As a rule, these studies were performed using cell lines, isolated monocytes, and macrophages. At the same time, the influence of LPS and the modulating effect of AMP on the expression of cytokine genes by other leukocytes in whole blood, particularly neutrophilic granulocytes, remains unnoticed, especially since neutrophilia occurs when LPS is administered, i.e., the fraction of neutrophils in the blood is up to 60% of all leukocytes. Although the translational apparatus of neutrophils is significantly reduced, they can contribute to the production of biologically active compounds. Thus, it has been shown that when LPS is administered intradermally to humans, neutrophils were the main source of IL1β in the early stages of local inflammation in the injection zone [7].

The aim of this study was to investigate the immunomodulatory properties of human defensin (HNP-1) and porcine cathelicidin (protegrin PG-1) antimicrobial peptides in vivo under the conditions of inflammatory process initiation, which were assessed by measuring the changes in the gene expression of toll-like receptor TLR4 and cytokines IL1β and IL10 in isolated mononuclear cells and whole blood of animals.

MATERIALS AND METHODS

Animals

The experiments were performed on male Wistar rats weighing 150-200 g. The animals were kept under vivarium conditions at room temperature with a 12-h light/dark cycle and free access to water and food (standard diet in accordance with the current requirements for keeping laboratory animals (European Convention for the Protection of Vertebrate Animals Used for Experimental and Other Scientific Purposes, https://rm.coe.int/168007a67b).

Reagents

Defensin NNP-1 was isolated from human leukocytes using a modified method [8], that includes extraction of peptides from cells using a mixture of methanol and acetic acid, separation by preparative electrophoresis, and final purification by high-performance liquid chromatography. The modification consisted of an additional separation step using preparative electrophoresis. The purity of the isolated defensin preparations was assessed using mass spectrometry.

Protegrin PG-1 was obtained by solid-phase chemical synthesis on an automatic peptide synthesizer Symphony X (Protein Technologies, USA). The purity of the obtained preparations was assessed using mass spectrometry.

LPS from Escherichia coli serotype 055:B5 (Sigma, USA) was used.

Experimental model

The inflammatory process was initiated by administering LPS to the animals. Animals were divided into four groups (five rats per group): (1) LPS injection, (2) LPS and AMP (defensin HNP-1 or protegrin PG-1) injection, (3) AMP (defensin HNP-1 or protegrin PG-1) injection, and (4) intact animals.

LPS and AMP were administered intraperitoneally (500 μl of aqueous solutions) at the following concentrations: LPS – 500 μg/kg animal weight; peptides – 400 μg/kg animal weight. Antimicrobial peptides were administered to rats of group 2 five minutes after LPS administration. Blood samples were collected 2 h after LPS and/or AMP administration. Two independent experiments were conducted.

The density gradient sedimentation method was used to isolate the mononuclear cell fraction from the whole blood of rats. Histopaque 1077 solution (Sigma-Aldrich, USA) was used as a gradient.

Measurement of gene expression

RNA was isolated from mononuclear cells using a commercial GeneJET RNA Purification Kit (Thermo Scientific, USA) according to the manufacturer’s protocol. RNA isolation from whole blood was performed using a commercial GeneJET Stabilized and Fresh Whole Blood RNA Kit (Thermo Scientific, USA) according to the manufacturer’s protocols.

A BioLabMix cDNA synthesis kit (M-MuLV-RH, Russia) was used to obtain cDNA. The obtained cDNA was stored at -20°C.

Real-time PCR was performed using the Bio-Rad CFX96 Touch™ real-time system. BioMaster HS-Taq PCR (2×) from BioLabMix was used for the PCR. The glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene was used as a reference gene. Primer sequences (5’-3’) were as follows: Il1b sense (AACAGCAATGGTCGGGACATA), Il1b antisense (CATTAGGAATAGTGCAGCCATCTTTA), Il10 sense (GAAGACCCTCTGGATACAGCTGC), Il10 antisense (TGCTCCACTGCCTTGCTTT), Tlr4 sense (CCTGAAGATCTTAAGAAGCTAT), Tlr4 antisense (CCTTGTCTTCAATTGTCTCAAT), Gapdh sense (CCTGCACCACCAACTGCTTAGC), Gapdh antisense (GCCAGTGAGCTTCCCGTTCAGC).

PCR protocol: 95.0°C – 10 min; 94.0°C – 15 sec; 60.0°C – 1 min; 72.0°C – 1 sec (fluorescence reading). Steps 2-4 were repeated 40 times. Melting curves were acquired using 0.5°C steps from 60.0°C to 94.0°C; 10.0°C to 10 min. The reaction products were evaluated and identified using a melting curve analysis. The results were processed using the CFX Manager™ software version 2.1.1022.0523.

Statistical analysis

The data were statistically processed using Statistica 10.0. The significance of differences between groups was assessed using the nonparametric Mann–Whitney U test. The level of significance was set at 95% (p<0.05).

RESULTS

The effect of intraperitoneal administration of defensin HNP-1 and protegrin PG-1 on the gene expression of pro-inflammatory cytokine IL1β, TLR4, and anti-inflammatory cytokine IL10 in peripheral blood cells and mononuclear cells of rats under inflammatory conditions initiated by LPS administration was investigated.

The experiment showed that the administration of defensin HNP-1 significantly reduced the gene expression of rat interleukin IL1β in the total fraction of whole blood cells 2 h after LPS administration but did not change it in isolated mononuclear cells (Fig. 1).

Fig. 1.

Relative Il1b (versus Gapdh) expression in rat whole blood cells (A) and mononuclear cells (B) in the experiment with HNP-1. All data were normalized to the values obtained for the group of intact animals. Animal groups: 1 – LPS injection; 2 – LPS and HNP 1 injection; 3 – HNP-1 injection; 4 – intact animals. (*) indicates p<0.05 vs. group 4; (#) indicates p<0.05 vs. group 1, according to the nonparametric Mann–Whitney U test.

The administration of PG-1 did not reduce LPS induced Il1b expression in leukocytes (Fig. 2).

Fig. 2.

Relative Il1b (versus Gapdh) expression in rat whole blood cells (A) and mononuclear cells (B) in the experiment with PG-1. All data were normalized to the values obtained for the group of intact animals. Animal groups: 1 – LPS injection; 2 – LPS and PG-1 injection; 3 – PG-1 injection; 4 – intact animals. (*) indicates p<0.05 vs. group 4 according to the nonparametric Mann–Whitney U test.

Traditionally, it is believed that the main ligands of TLRs are pathogen-associated molecular patterns. Specifically, TLR4 binds mainly to LPS, which activates the NF-κB signalling pathway, leading to the synthesis of pro-inflammatory cytokines. Therefore, the regulation of TLR4 expression upon the introduction of LPS into an organism is of particular interest. Endogenous compounds have recently been added to the list of TLR ligands, including neutrophil granulocyte proteins (lactoferrin and elastase) [9]. In this regard, the study of the influence of other components of neutrophil granules on the gene expression of TLR4 may reveal an important aspect of the regulation of the inflammatory process by antimicrobial peptides.

It was shown that Tlr4 expression increased in whole blood cells 2 h after the administration of LPS to animals but did not change in mononuclear cells. With the combined administration of LPS and HNP-1, Tlr4 expression in whole blood cells was significantly different from that of the positive control (LPS injection) and the negative control (intact animals). In contrast, in mononuclear cells, the combined administration of defensin and LPS did not change the expression of the Tlr4, whereas the administration of defensin without LPS caused an increase in the gene expression of this receptor (Fig. 3).

Fig. 3.

Relative Tlr4 (versus Gapdh) expression in rat whole blood cells (A) and mononuclear cells (B) in the experiment with HNP-1. All data were normalized to the values obtained for the group of intact animals. Animal groups: 1 – LPS injection; 2 – LPS and HNP-1 injection; 3 – HNP-1 injection; 4 – intact animals. (*) indicates p<0.05 vs. group 4; (#) indicates p<0.05 vs. group 1, according to the nonparametric Mann–Whitney U test.

PG-1 administration did not affect LPS-stimulated Tlr4 expression in whole blood cells, but at the same time caused a similar increase in Tlr4 expression as HNP-1 in blood mononuclear cells (Fig. 4).

Fig. 4.

Relative Tlr4 (versus Gapdh) expression in rat whole blood cells (A) and mononuclear cells (B) in the experiment with PG-1. All data were normalized to the values obtained for the group of intact animals. Animal groups: 1 – LPS injection; 2 – LPS and PG-1 injection; 3 – PG-1 injection; 4 – intact animals. (*) indicates p<0.05 vs. group 4 according to the nonparametric Mann–Whitney U test.

One of the mechanisms limiting uncontrolled synthesis of pro-inflammatory cytokines is the presence of anti-inflammatory cytokines in the cytokine network. For example, it is known that interleukin IL10 inhibits the production of pro-inflammatory cytokines IL1β, IL6 and TNFα by activated macrophages [10].

The experiment showed that LPS administration increased the gene expression of interleukin IL10 in whole blood cells, while it remained unchanged in mononuclear cells.

The consequent administration of both HNP-1 and PG-1 antimicrobial peptides had the same effect; there was a decrease in the expression of the interleukin gene to the level of the intact group in whole blood cells, while it did not cause any changes in mononuclear cells (Fig. 5, 6).

Fig. 5.

Relative Il10 (versus Gapdh) expression in rat whole blood cells (A) and mononuclear cells (B) in the experiment with HNP-1. All data were normalized to the values obtained for the group of intact animals. Animal groups: 1 – LPS injection, 2 – LPS and HNP-1 injection, 3 – HNP-1 injection, 4 – intact animals. (*) indicates p<0.05 vs. group 4; (#) indicates p<0.05 vs. group 1 according to the nonparametric Mann–Whitney U test.

Fig. 6.

Relative Il10 (versus Gapdh) expression in rat whole blood cells (A) and mononuclear cells (B) in the experiment with PG-1. All data were normalized to the values obtained for the group of intact animals. Animal groups: 1 – LPS injection; 2 – LPS and PG-1 injection; 3 – PG-1 injection; 4 – intact animals. (*) indicates p<0.05 vs. group 4 according to the nonparametric Mann–Whitney U test.

DISCUSSION

As mentioned earlier, endogenous antimicrobial peptides have an increased affinity for bacterial cell wall components; therefore, it was assumed that the basis of their endotoxin-neutralizing action is their ability to bind to LPS, thereby affecting the activation of the TLR4 and the production of pro-inflammatory cytokines.

Both peptides used in this study bind to and neutralize LPS in vitro [11]; however, when they were administered to animals, we observed different effects on LPS-stimulated gene expression of the pro-inflammatory cytokine IL1β. The immunomodulatory effect of AMPs in vivo, evaluated as a decrease in the level of LPS-stimulated gene expression of IL1β cytokine, does not directly depend on the cationic nature of the molecule or its ability to bind LPS. It should be noted that protegrins and defensins have different tertiary structures; therefore, it is possible that the indirect effect of defensins on gene expression may be associated with a certain type of receptor. For example, it has been shown that avian β-defensins can serve as ligands for the TLR4 [12]. It can be assumed that the route of administration also affects the immunomodulatory properties of AMPs, since combined intravenous administration of the studied peptides and LPS reduced LPS-stimulated gene expression of IL1β in blood mononuclear cells [11].

It is known that the administration of LPS to animals affects the gene expression of TLR4 to different extents in various organs. It was shown that after intraperitoneal injection of LPS in mice, the level of Tlr4 mRNA in the brain decreased 3 h after injection, and this decrease persisted for up to 24 h with a slight recovery. In the heart and lungs, Tlr4 expression increased, and in the liver, kidney, and spleen, Tlr4 mRNA levels did not change [13]. At the same time, in the spleen of rats, there was a decrease in Tlr4 expression 3 h after intraperitoneal injection of LPS [14]. Tlr4 expression was downregulated after 2-hour LPS treatment in vitro in mouse macrophages [15].

Speaking about the level of Tlr4 expression in neutrophils, it has been shown that intense physical exercise leads to an increase in the level of this receptor gene expression in human blood neutrophils three hours after exposure [16]. The authors associated this phenomenon with an increase in blood myoglobin level, which is an indicator of muscle damage. Although it is possible that this may be caused by an increase in the concentration of bacterial LPS in the blood, which has been observed during intense exercise [17]. It is worth noting that neutrophil-derived AMPs are also alarmins. Therefore, it is possible that, in our experiments, an increase in Tlr4 expression in mononuclear cells upon administration of AMPs is the reaction of the organism to analogs of endogenous alarmins. Most likely, the main contributors to this increase are monocytes, whereas in whole blood, this reaction is levelled because of the lower percentage of these cells.

The increase in Il10 expression in whole blood cells as opposed to mononuclear cells during intraperitoneal administration of LPS in animals indicated that neutrophils could act as producers of biologically active compounds during the development of the inflammatory process.

It is worth noting the difference in the effects of defensin administration on the gene expression of pro-inflammatory cytokine IL1β and anti-inflammatory cytokine IL10. In the case of IL1β there was a decrease in the expression level, but not its suppression to the level of the intact group, which was observed for IL10. It can be assumed that at the early stage of the inflammatory process, endogenous defensins can act as moderate pro-inflammatory factors, suppressing the gene expression of anti-inflammatory cytokines, but at the same time slightly reducing the gene expression of pro-inflammatory cytokine.

Funding:

This work was supported by State Contract no. 122020300189-6.

Acknowledgements:

The authors express their deepest gratitude to T. A. Filatenkova for assistance in working with animals and to A. S. Komlev for providing the synthesized protegrin PG-1.

Conflict of interest:

The authors have no commercial or financial interests.

REFERENCES

1. Akira S, Takeda K, Kaisho T. Toll-like receptors: critical proteins linking innate and acquired immunity. Nat. Immunol. 2001;2(8):675-80. https://doi.org/10.1038/90609.

2. Bowdish DME, Davidson DJ, Scott MG, Hancock REW. Immunomodulatory activities of small host defense peptides. Antimicrob Agents Chemother. 2005;49:1727-32. https://doi.org/10.1128/aac.49.5.1727-1732.2005.

3. Mookherjee N, Brown KL, Bowdish DM, Doria S, Falsafi R, Hokamp K, et al. Modulation of the TLR-mediated inflammatory response by the endogenous human host defense peptide LL-37. J Immunol. 2006; 176:2455-64. https://doi.org/10.4049/jimmunol.176.4.2455.

4. Lee SH, Jun HK, Lee HR, Chung CP, Choi BK. Antibacterial and lipopolysaccharide (LPS)-neutralising activity of human cationic antimicrobial peptides against periodontopathogens. Int J Antimicrob Agents. 2010;35(2):138-45. https://doi.org/10.1016/j.ijantimicag.2009.09.024.

5. Motzkus D, Schulz-Maronde S, Heitland A, Schulz A, Forssmann WG, Jübner M, et al. The novel beta-defensin DEFB123 prevents lipopolysaccharide-mediated effects in vitro and in vivo. FASEB J. 2006;20(10):1701-2. https://doi.org/10.1096/fj.05-4970fje.

6. Semple F, Webb S, Li HN, Patel HB, Perretti M, Jackson IJ, et al. Human β-defensin 3 has immunosuppressive activity in vitro and in vivo. Eur JImmunol. 2010;40(4):1073-8. https://doi.org/10.1002/eji.200940041.

7. Basran A, Jabeen M, Bingle L, Stokes CA, Dockrell DH, Whyte MK, et al. Roles of neutrophils in the regulation of the extent of human inflammation through delivery of IL-1 and clearance of chemokines. J Leukoc Biol. 2013;93(1):7-19. https://doi.org/10.1189/jlb.0512250.

8. Tang YQ, Yuan J, Miller CJ, Selsted ME. Isolation, characterization, cDNA cloning, and antimicrobial properties of two distinct subfamilies of alpha-defensins from rhesus macaque leukocytes. Infect Immun. 1999;67(11):6139-44. https://doi.org/10.1128/IAI.67.11.6139-6144.1999.

9. Piccinini AM, Midwood KS. DAMPening inflammation by modulating TLR signaling. Mediators Inflamm. 2010;2010:1-22. https://doi.org/10.1155/2010/672395.

10. Sabat R, Grütz G, Warszawska K, Kirsch S, Witte E, Wolk K, et al. Biology of interleukin-10. Cytokine Growth Factor Rev. 2010;21(5):331-44. https://doi.org/10.1016/j.cytogfr.2010.09.002.

11. Aleshina GM, Shamova OV, Perekrest SV, Semochkina AY, Budyukina IA, Filimonov VB, et al. Endotoxin-neutralizing effect of antimicrobial peptides. Tsitokiny i vospalenie (Cytokines and Inflammation). 2013;12(1-2):72-7. (In Russian).

12. Yang Y, Jiang Y, Yin Q, Liang H, She R. Chicken intestine defensins activated murine peripheral blood mononuclear cells through the TLR4-NF-kappaB pathway. Vet Immunol Immunopathol. 2010;133(1):59-65. https://doi.org/10.1016/j.vetimm.2009.07.008.

13. Matsumura T, Ito A, Takii T, Hayashi H, Onozaki K. Endotoxin and cytokine regulation of toll-like receptor (TLR) 2 and TLR4 gene expression in murine liver and hepatocytes. J Interferon Cytokine Res. 2000;20(10):915-21. https://doi.org/10.1089/10799900050163299.

14. Yankelevich IA, Filatenkova TA, Aleshina GM. Human lactoferrin modulates gene expression of the cytokine IL4 and the receptor TLR4 in the rat spleen under stress and upon the lipopolysaccharide administration. MIR J. 2023;10(1):59-64. https://doi.org/10.18527/2500-2236-2023-10-1-59-64.

15. Poltorak A, He X, Smirnova I, Liu MY, Van Huffel C, Du X, et al. Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice: mutations in tlr4 gene. Science. 1998;282:2085-8. https://doi.org/10.1126/science.282.5396.2085.

16. Neubauer O, Sabapathy S, Lazarus R, Jowett JB, Desbrow B, Peake JM, et al. Transcriptome analysis of neutrophils after endurance exercise reveals novel signaling mechanisms in the immune response to physiological stress. J Appl Physiol. 2013;114:1677-88. https://doi.org/10.1152/japplphysiol.00143.2013.

17. Ashton T, Young IS, Davison GW, Rowlands CC, McEneny J, Van Blerk C, et al. Exercise-induced endotoxemia: the effect of ascorbic acid supplementation. Free Radic Biol Med. 2003;35(3):284-91. https://doi.org/10.1016/s0891-5849(03)00309-5.