1. INTRODUCTION
Pancreatic ductal adenocarcinoma (PDAC), a prevalent and aggressive form of cancer, originates from the cells lining the pancreatic ducts; ductal metaplasia can also develop from acinar cells [1]. PDAC typically is diagnosed in late stages and has limited treatment options, thus posing substantial challenges for effective management [2–4]. Gemcitabine (Gem), a chemotherapy drug, is a frequently used frontline therapy for PDAC [5, 6]. However, the development of resistance to Gem significantly hinders treatment effectiveness in clinical settings. This resistance poses a major obstacle to successful treatment and underscores the urgent need to identify adjuvants that enhance the chemosensitivity of PDAC cells to Gem, thereby improving treatment outcomes for this deadly malignancy.
Nuclear factor erythroid 2-related factor 2 (Nrf2), a transcription factor, plays a crucial role in the cellular response to oxidative stress. Normally, Nrf2 is bound to its inhibitor protein, Keap1 (Kelch-like ECH-associated protein 1), in the cytoplasm [7]. However, when cells experience oxidative stress, Nrf2 dissociates from Keap1 and translocates to the nucleus. In the nucleus, Nrf2 binds antioxidant response elements (AREs) on target genes, and subsequently promotes their transcription and facilitates cellular defense against oxidative damage. Mutations in Keap1 or Nrf2 are associated with several diseases, including cancer, neurodegenerative disorders, and inflammatory diseases. Moreover, disruptions in the Keap1-Nrf2 pathway are associated with cancer progression and resistance to chemotherapy; therefore, this pathway is an attractive target for cancer treatment strategies [8, 9]. Nrf2 has been implicated in the regulation of multidrug resistance-associated proteins (MRPs) in cancer cells. MRPs are ATP-binding cassette transporter family members that are involved in the efflux of chemotherapeutic agents from cancer cells, thereby leading to drug resistance. Activation of Nrf2 upregulates MRP expression and contributes to the development of chemotherapy resistance [10, 11]. Nrf2 is frequently overactivated in PDAC, and consequently promotes tumor growth and chemoresistance [12]. Additionally, Gem further elevates the high expression of Nrf2 [13]. In contrast, inhibiting Nrf2 sensitizes cancer cells to Gem, decreases the expression of MRPs, and enhances chemotherapy effectiveness. Consequently, targeting Nrf2 has emerged as a potential strategy to overcome drug resistance in cancer cells. These findings illustrate the need to identify compounds that suppress Nrf2 activity and to develop them into drugs that enhance the effectiveness of cancer treatments.
Brusatol (BRT), a quassinoid compound, was originally isolated from the seeds of Brucea javanica [14–16]. BRT inhibits the activation of Nrf2 in various cancer cells [15, 17]. We have reported that BRT exhibits growth inhibitory and pro-apoptotic effects in pancreatic cancer cells [18]. However, the specific mechanism through which BRT exerts its inhibitory effects in PDAC remains to be fully understood. Herein, we found that BRT enhances the sensitivity of PDAC cells to Gem and reverses Nrf2 activation by regulating the Nrf2 pathway at the transcriptional level. Our findings suggest that BRT may be a promising potential candidate to augment the anticancer properties of Gem and enhance its therapeutic effects in PDAC, thus contributing to the clinical treatment of PDAC.
2. MATERIAL AND METHODS
2.1 Reagents
Brusatol (BRT, lot RFS-c01601908021; purity HPLC ≥99%) was purchased from Chengdu Herbpurity Co, Ltd (Chengdu, China). Gem was obtained from Selleck Chemicals Co. Ltd (cat. S1149; Houston, TX, USA) with purity above 99.96%. The chemical structures of BRT and Gem are shown in Figure 1a .
BRT enhances the chemosensitivity of PDAC cells to Gem.
(a) Chemical structure of BRT. (b) Miapaca-2, Capan-2, and PANC-1 cells were treated with the indicated concentrations of BRT for 48 h, and cell viability was assessed with CCK8 assays. (c) IC50 of BRT in PDAC cell lines, determined through cell viability assays. (d) Miapaca-2 and Capan-2 cells were treated with BRT or/and Gem for 48 h, and CCK8 assays were used to measure cell viability. (e) The combination index (CI) of BRT and Gem co-treatment on the pancreatic cell lines. CI values <1 indicate synergism (CI <0.1–0.3 indicates strong synergism; CI <0.3–0.7 indicates synergism; CI <0.7–0.85 indicates moderate synergism; CI = 1 indicates nearly additive effects; and CI >1 indicates antagonism). Data are presented as mean ± SD (n = 3). *p < 0.05, **p < 0.01, and ***p < 0.001 compared with the control group.
2.2 Cell culture
Human PDAC cell lines including PANC-1 (RRID CVCL_VQ69) and Capan-2 (RRID CVCL_0026) were obtained from the American Type Culture Collection (Manassas, VA, USA). The Miapaca-2 (RRID CVCL_0428) cell line was generously provided by Prof. XU Hong-Xi (Shanghai University of Traditional Chinese Medicine, Shanghai, China). The cell lines were cultured as described in our prior publication [19].
2.3 Cell viability assays
Cells were seeded into 96-well plates at a density of 3,000 cells per well and subsequently exposed to various concentrations of drugs for 48 hours. Cell viability was assessed with Cell Counting Kit 8 (CCK-8) assays according to the manufacturer’s protocol. In brief, 10 μL CCK-8 solution was added to each well, and the cells were incubated for 3 hours before measurement. Absorbance at 450 nm was then quantified with a FLUOstar OPTIMA microplate reader (BMG Labtech, Offenbury, Germany).
The interaction effect between BRT and Gem was analyzed with the combination index (CI). The CI value was calculated with the Loewe additivity equation: CI = (D)1/(Dx)1 + (D)2/(Dx)2, where (Dx)1 and (Dx)2 are the concentrations of D1 (BRT) and D2 (Gem) alone that inhibit x% cell growth, and (D)1 and (D)2 are the concentrations of BRT and Gem in combination that result in identical cell growth inhibition.
2.4 Colony formation assays
Cells were collected, resuspended, and plated on 12-well plates at a density of 150 cells per well, then incubated overnight. The cells were then treated with BRT or Gem alone, or a combination thereof, for the specified duration. After drug treatment, the medium was replenished with fresh growth medium without drugs, and the cells were incubated for an additional 10 days before fixation with 4% formaldehyde and staining with 0.5% crystal violet. Colony counting was performed according to previously established methods [19].
2.5 FACS apoptosis assays
Cellular apoptosis levels were measured via flow cytometry with an Annexin V/PI staining kit, according to the manufacturer’s guidelines (BD Pharmingen™, USA). Apoptotic cells were identified with a Cytomics™ FC500 flow cytometer (Beckman Coulter, Fullerton, CA, USA). Flow cytometry data were analyzed in Kaluza software (Beckman Coulter; RRID SCR_016182). Additionally, apoptosis was assessed through Hoechst 33342 staining, according to the protocol provided by the manufacturer (Invitrogen, Carlsbad, CA, United States).
2.6 Cell death detection by ELISA
Miapaca-2 and Capan-2 cells were seeded in six-well plates and incubated overnight. Subsequently, the cells were exposed to 1.5 μM BD, 0.5 μM BRT, 100 μg/mL Gem, or combinations thereof for 48 hours. After treatment, the cells were collected and analyzed with a Cell Death Detection ELISA kit (cat. No. 11544675001, Roche, Switzerland), according to the manufacturer’s protocol.
2.7 Lactic acid determination
Lactic acid concentrations were determined with a Lactic Acid Assay Kit (Nanjing Jiancheng Bioengineering Institute, China, cat. No. A109-2-1), according to the manufacturer’s guidelines. Absorbance readings were obtained at 530 nm with a FLUOstar OPTIMA microplate reader (BMG Labtech, Offenbury, Germany).
2.8 Immunofluorescence staining
PDAC cells were seeded onto coverslips and allowed to adhere overnight before being exposed to BRT (0.5 μM) for 24 hours. Subsequently, the cells were fixed with 4% paraformaldehyde in PBS, blocked with 5% BSA in PBS, and incubated with primary antibodies to Nrf2 (1:100 dilution; Santa Cruz #sc-365949) in PBS containing 3% BSA. Subsequently, the cells were incubated with Cy3-labeled secondary antibodies (Abcam, United Kingdom). Nuclei were counterstained with DAPI (Santa Cruz, Texas, USA). Imaging was performed with an inverted fluorescence microscope (Carl Zeiss, Germany).
2.9 Western blot analysis
Western blotting was conducted according to established protocols [19] using specific antibodies. The secondary antibodies were HRP-conjugated goat anti-mouse IgG or goat anti-rabbit IgG, both at dilutions of 1:2,500, from Cell Signaling Technology. Protein levels were normalized to the endogenous control β-actin. The antibodies used in this experiment, along with their respective dilutions, are indicated in Supplementary Table S1 .
2.10 Lentiviral transfection of Nrf2 shRNA and stable cell lines
Stable cell lines were established through a method described in our prior publication [19]. Lentiviral particles containing Nrf2 shRNA or control shRNA were acquired from Santa Cruz (sc-37030-V and sc-108080, respectively). Polybrene (Santa Cruz), a reagent to increase transfection efficiency, was used at a concentration of 5 μg/mL.
2.11 Measurement of Nrf2 protein stability and ubiquitination
Cells were treated with BRT (0.5 μM) and MG132 (20 μM) (Sigma M8699). After treatment for a specified duration, the cells were collected for western blot analysis to assess Nrf2 protein levels. The half-life of Nrf2 in cells was determined through cycloheximide (CHX)-chase analysis. Cells were treated with BRT (0.5 μM) and CHX (25 μM) or CHX(25 μM) alone. Total cell extracts were prepared at designated time points after CHX treatment (Sigma C7698), and western blot analysis was performed on the cell extracts. For the evaluation of Nrf2 ubiquitination, cells were treated with BRT (0.5 μM) for varying durations (0–48 hours), and the ubiquitination level was assessed via western blotting with anti-ubiquitin antibodies.
2.12 Molecular docking analysis
Molecular docking analysis of BRT on Nrf2 was conducted with AutoDock Vina. The three-dimensional structure of BRT was sourced from the PubChem database (RRID SCR_004284; compound CID 73432), whereas the three-dimensional structure of the receptor protein Nrf2 was downloaded from the RCSB PDB Protein Data Bank. Subsequently, AutoDock Vina software was used to prepare the BRT ligand, through addition of hydrogen atoms and assignment of partial charges, and removal of any water molecules in the Nrf2 receptor. After ligand and receptor preparation, grid generation and ligand docking were performed sequentially. The outcomes were then visualized in PyMOL software to analyze the spatial arrangement of the protein involved in the interaction with BRT (RRID SCR_000305). Furthermore, Discovery Studio 4.5 Client software was used to generate two-dimensional visualizations of the results. Ligand binding results showing negative △G values indicated an affinity between BRT and Nrf2.
2.13 RNA extraction and real-time PCR
The RNA extraction and qRT-PCR procedures were conducted with the methods and reagents described in our previous publication [19]. The qPCR primers used in this study were as follows: Nrf2 (forward), TCCAGTCAGAAACCAGTGGAT; Nrf2 (reverse), GAATGTCTGCGCCAAAAGCTG; β-actin (forward), GGACCTGACCTGCCGTCTAG; and β-actin (reverse), GTAGCCCAGGATGCCCTTGA. β-actin served as the internal control.
2.14 Animal in vivo study
Female BALB/c nude mice (18 ± 2 g, 6 weeks old) were obtained from the Laboratory Animal Services Centre, The Chinese University of Hong Kong. Animal experiments were approved by the Animal Experimentation Ethics Committee of the Chinese University of Hong Kong (ref. No. 19/079/NSF). Briefly, Miapaca-2-shControl and Miapaca-2-shNrf2 cells (1.5 × 106 cells/100 μL) were injected into the pancreatic tail in each mouse. The mice were randomly divided into four groups treated with vehicle, Gem (20 mg/kg twice per week, i.g.), BRT (1 mg/kg, daily, i.g.), or both Gem and BRT for 25 days. Body weights was recorded every 2 days. At the end of drug treatment, the mice were sacrificed, and the tumor tissues were harvested for western blot and immunohistochemistry analysis. Tumor volumes were calculated as (a × b × b)/2 (where a indicates the largest diameter, and b indicates the smallest diameter).
2.15 H&E and immunohistochemistry staining
Tumor tissues were fixed with formalin and embedded in paraffin, and tissue sections were prepared and stained with H&E to assess tissue pathology. Immunohistochemistry (IHC) staining for Nrf2 and Ki-67 was performed with a standard protocol. An inverted fluorescence microscope (Carl Zeiss, Germany) was used to photograph all sections.
2.16 Statistical analysis
The mean and standard deviation (SD) were computed for each experimental group. Group differences were assessed with one-way ANOVA, and differences between two groups were analyzed with t-test. A threshold of p < 0.05 was considered to indicate statistical significance among groups. Figures were generated with GraphPad Prism (RRID SCR_002798).
3. RESULTS
3.1 BRT enhances the chemosensitivity of PDAC cells to Gem
We have previously reported that BRT has anti-cancer characteristics in various cancers [18, 20–22]. Herein, we examined the effects of BRT treatment on the survival of PDAC cell lines. BRT markedly inhibited the proliferation of PDAC cells ( Figure 1a and 1b ). Furthermore, CCK8 assays indicated that BRT treatment enhanced the sensitivity of Miapaca-2 and Capan-2 cells to Gem treatment, thus leading to more pronounced inhibition of cell proliferation than observed with treatment with Gem alone ( Figure 1d ). The CI for every combination treatment was less than 1 in both PDAC Miapaca-2 and Capan2 cells ( Figure 1e ), thereby indicating the synergistic effects of the combination treatment. We subsequently examined the effects of BRT in combination with Gem on cell growth in colony formation assays. Notably, combination treatment with BRT and Gem exhibited significantly greater inhibition of cell colony formation in both Miapaca-2 and Capan-2 cells than Gem treatment alone ( Supplementary Figure 1a ). These findings indicated that BRT potentiates the efficacy of Gem in PDAC, through a strong inhibitory effect on cell proliferation, and enhances the sensitivity of PDAC cells to Gem treatment.
3.2 BRT enhances Gem-induced apoptosis in PDAC cells
To further investigate whether BRT might enhance the efficacy of Gem in promoting apoptosis in PDAC cells, we conducted Hoechst 33342 nuclear staining and Annexin V-FITC/PI flow cytometry assays. Cells treated with a combination of BRT and Gem exhibited classical apoptotic features, such as cellular shrinkage and cell wall blebs ( Figure 2a ). We also examined the effects of BD combined with Gem on the indicated cells, because BD has been reported to enhance Gem chemosensitivity in PDAC cells [19]. This apoptotic response was further validated by Annexin V-FITC/PI staining, which indicated an increased proportion of Annexin V-positive cells in both PDAC cells after combination treatment ( Figure 2b and 2c ). We then assessed apoptotic effects with a Cell Death Detection ELISA kit. DNA fragmentation increased with treatment with BRT, BD, Gem, or their combination with Gem, and statistically significant differences were observed in the control versus BRT, BD, or their combination ( Figure 2d ). Furthermore, the combination treatment resulted in lower protein levels of apoptosis-associated proteins, including pro-caspase-3, pro-caspase-9, and PARP than observed in the Gem group, thus also indicating an augmented effect on apoptotic induction ( Figure 2e ). Cancer has been associated with abnormal lactate metabolism, and high level of lactic acid contribute to a more malignant phenotype of cancer cells, and promote cancer development and progression [23–25]. Therefore, we investigated whether Gem-treated PDAC cells might have abnormal lactic acid levels, and whether BRT might mitigate these abnormalities. Gem administration slightly increased the lactic acid content, whereas the lactic acid content significantly decreased after treatment with BRT in PDAC cells ( Figure 2f ).
BRT enhances the sensitivity of human PDAC cells to Gem.
(a) Cells were subjected to nuclear morphological analysis with Hoechst 33342 after treatment with BD (1.5 μM), BRT (0.5 μM), Gem (100 μg/mL), or combinations thereof for 48 h. Representative fluorescence images of Hoechst 33342 positive cells are shown. Scale bar: 50 μm (Yellow arrows show live cells, green arrows represent apoptotic bodies, and altered nuclei are in bright blue). (b and c) Annexin V/PI cytometric analysis of drug-treated Miapaca-2 and Capan-2 cells, and quantification of cellular apoptosis. (d) Cells were exposed to BD, BRT, and Gem for 48 h, then analyzed with a Cell Death Detection ELISA kit. (e) Protein expression levels of Caspase-3, Caspase-9, and PARP in PDAC cells were measured after treatment with a combination of BD, BRT, and Gem. (f) The content of lactic acid in PDAC cells was determined after treatment with BD (1.5 μM), BRT (0.5 μM), Gem (100 μg/mL), or combinations thereof for 48 h. Data are presented as mean ± SD (n = 3). *p < 0.05, **p < 0.01, and ***p < 0.001 compared with the control group; ## p < 0.01 and ### p < 0.001 compared with the Gem alone group.
3.3 BRT inhibits the Nrf2 pathway in PDAC cells
In our previous study, we observed that Nrf2 is aberrantly overexpressed in PDAC cells and is predictive of poor prognosis [19]. BRT has been reported to inhibit Nrf2 activation in various cancer cells [26–29]. Therefore, we detected BRT’s effects on inhibition of Nrf2 protein expression in Miapaca-2 and Capan-2 cells. Nrf2 expression significantly decreased after treatment with 0.1, 0.5, or 1.5 μM BRT for 24 h ( Figure 3a and 3b ). Subsequently, the inhibitory effects of BRT (0.5 μM) on Nrf2 protein in Miapaca-2 and Capan-2 cells were observed at different time points ( Figure 3c and 3d ). Consistently, the downstream pathway of Nrf2 include NQO1, HO-1, AKR1B10, γ-GCSm and MRP1 and MRP5 was also reduced by BRT in a time- and dose-dependent manner ( Supplementary Figure 2a and 2b ). We also performed molecular docking to assess the interaction between BRT and Nrf2. BRT showed many interactions with Nrf2 protein sites, and the binding affinity of BRT toward Nrf2 was −9.3 kcal/mol ( Figure 3e and 3f ). In addition, BRT was found to form five hydrogen bonds with the residues Arg-326 (3.31 Å), His-516 (3.24 Å), Thr-560 (3.18 Å and 2.52 Å), and Val-608 (3.09 Å) in the catalytic pocket of Nrf2, thus potentially promoting stable binding between BRT and Nrf2 ( Figure 3g ). These findings indicated that BRT effectively inhibits Nrf2 protein expression in PDAC cells and may exert its effects by suppressing Nrf2 signaling pathways. Consequently, BRT has the potential to enhance the chemosensitivity of PDAC cells to Gem by targeting Nrf2.
BRT selectively inhibits the Nrf2 pathway.
(a-b) Miapaca-2 and Capan-2 cells were treated with different concentrations of BRT (0–1.5 μM) for 24 h. (c) Miapaca-2 and Capan-2 cells were treated with BRT (0.5 μM) for 24 h, and western blotting was used to detect the protein levels of Nrf2 and its downstream signaling proteins, such as NQO-1, HO-1, AKR1B10, and γ-GCSm. (d) Statistical analysis of relative protein levels from Figure 3a and 3b . (e) Three-dimensional interaction structure between BRT and Nrf2 protein. (f) Detailed schematics of the three-dimensional interaction diagram of BRT and Nrf2 protein. (g) Two-dimensional interaction diagram of the contacts between BRT and Nrf2 protein. Green represents hydrogen bonding. Data are presented as mean ± SD (n = 3). *p < 0.05, **p < 0.01, and ***p < 0.001 compared with the control group.
3.4 BRT abrogates Gem-induced Nrf2 activation
Gem treatment has been found to elevate the expression of Nrf2 [13]. Therefore, we investigated the effects of BRT on Nrf2 activation induced by Gem in PDAC cells. BRT significantly inhibited Gem-induced Nrf2 activation ( Figure 4a and 4b ). Furthermore, immunostaining for endogenous Nrf2 confirmed that treatment with 0.5 μM BRT effectively decreased the protein levels of Nrf2 induced by Gem in Miapaca-2 and Capan-2 cells ( Figure 4c and Supplementary Figure 3a ). These findings suggested that BRT exerts inhibitory effects on Gem-induced Nrf2 up-regulation in PDAC cells by decreasing the protein expression of Nrf2, thus further highlighting its potential as a therapeutic strategy for modulating Nrf2 signaling in PDAC.
BRT abrogates Gem-induced Nrf2 activation.
(a) Effects of BD, BRT, and Gem treatment on the protein levels of Nrf2, HO-1, NQO1, γGCSm, AKR1B10, and MRP5 in Miapaca-2 and Capan-2 cells. (b) Statistical analysis of relative protein levels from Figure 4a . (c) Immunostaining of endogenous Nrf2 in Miapaca-2 and Capan-2 cells treated with BRT (0.5 μM), Gem (100 μg/mL) or their combination for 24 h. All images are shown at 50 μm (scale bar). Data are presented as mean ± SD (n = 3). *p < 0.05, **p < 0.01, and ***p < 0.001 compared with the control group.
3.5 Activation of Nrf2 weakens the anti-proliferation and anti-apoptosis effects of BRT in PDAC cells
To further validate the effects of BRT on Nrf2, we used the Nrf2 inducer tert-butylhydroquinone (tBHQ) to pharmacologically activate Nrf2 expression, and subsequently determined whether the effects of BRT on Nrf2 activity remained consistent under conditions of increased Nrf2. Treatment with tBHQ resulted in overexpression of Nrf2, thus leading to a dose-dependent increase in cell viability, which was reversed by BRT treatment ( Figure 5a ). Additionally, Annexin V-PI staining was performed to assess whether tBHQ treatment might influence the cytotoxic effects of BRT in PDAC cells. Treatment with tBHQ counteracted the induction of apoptosis by BRT in Miapaca-2 and PANC-1 cells ( Figure 5b and 5c ), but did not affect the apoptotic effects of Gem ( Supplementary Figure 4a ). Furthermore, tBHQ treatment activated the Nrf2 pathway, as evidenced by increased activity of Nrf2 and upregulation of its downstream proteins ( Figure 5d and 5g ). However, BRT treatment partially inhibited Nrf2 activity, and attenuated the expression of downstream proteins such as MRP1 and MRP5 ( Supplementary Figure 4b ). These findings demonstrated that BRT-induced inhibition of Nrf2 plays a critical role in inducing cell death in PDAC cells. The ability of BRT to counteract the effects of tBHQ-induced Nrf2 activation further supports its potential as an effective therapeutic strategy to target Nrf2 signaling in PDAC.
The Nrf2 inducer tBHQ weakens the anti-proliferation and anti-apoptosis effects of BRT in PDAC cells.
(a) Cell viability was determined with CCK8 assays after treatment with the indicated concentrations of tBHQ, BRT, or a combination thereof for 48 h in Miapaca-2 and Capan-2 cells. (b and c) Annexin V/PI cytometric analysis of drug-treated Miapaca-2 and Capan-2 cells, and quantification of cellular apoptosis. (d and e) Effects of Nrf2 activation on the protein levels of HO-1, NQO1, AKR1B10, and γGCSm in Miapaca-2 and Capan-2 cells after treatment with tBHQ, BRT, or a combination thereof. (f and g) Statistical analysis of relative protein levels from Figure 5d and 5e . Data are presented as mean ± SD (n = 3). *p < 0.05, **p < 0.01, and ***p < 0.001 compared with the control group. # p < 0.05, ## p < 0.01, ### p < 0.001 compared with the tBHQ group.
3.6 Nrf2 knockdown augments the effects of BRT in enhancing chemosensitivity to Gem in human PDAC cells
The involvement of Nrf2 in the BRT-mediated sensitization of Gem in PDAC cells was further assessed in Miapaca-2 and PANC-1 cells with stable Nrf2 depletion. Silencing of Nrf2 expression significantly decreased the cell viability of PDAC cells to levels below those observed in the LV-shCtrl vehicle control group; moreover, BRT alone, Gem alone, or a combination thereof markedly decreased PDAC cell viability, to levels below those in the LV-shCtrl vehicle control group ( Figure 6a ). Although combination treatment with BRT and Gem showed slight synergistic effects on PDAC cell viability, the findings were not significantly different from those in the LV-shCtrl group ( Figure 6a ). To investigate the mechanism underlying the increased antitumor effect of BRT after Nrf2 knockdown, we evaluated mRNA levels of Nrf2. Nrf2 mRNA was significantly affected by BRT treatment before and after Nrf2 silencing ( Figure 6b ). Furthermore, we investigated the protein levels of Nrf2 and its downstream targets. Knockdown of Nrf2 attenuated Nrf2 activity, thus decreasing levels of downstream proteins such as HO-1, NQO1, γGCSm, AKR1B10, and MRP5. In addition, treatment with BRT after silencing of Nrf2 expression had a greater inhibitory effect than observed in cells without silenced Nrf2 ( Figure 6c and 6b ); therefore, BRT augmented the sensitivity of Miapaca-2 and PANC-1 cells to Gem by inhibiting Nrf2 signaling. These results indicated that Nrf2 plays a crucial role in the BRT-mediated sensitization of Gem in PDAC cells. Moreover, silencing of Nrf2 expression enhances the antitumor effects of BRT and Gem, and BRT treatment inhibits Nrf2 signaling, thus increasing the sensitivity of PDAC cells to Gem.
Nrf2 knockdown enhances the effects of BRT in increasing the chemosensitivity of human PDAC cells to Gem.
(a) Cell viability of Nrf2-silenced and non-silenced Miapaca-2 and PANC-1 cells was measured with CCK8 assays. (b) Relative Nrf2 mRNA expression levels in Miapaca-2 and PANC-1 cells were assessed in Nrf2-silenced and non-silenced cells, treated with or without BRT (0.5 μM) and Gem for 24 h. (c) Nrf2-silenced and Nrf2-Ctrl Miapaca-2 and PANC-1 cells, followed by BRT and Gem for 24 h. Cell lysates were analyzed by immunoblotting. (d) Statistical analysis of relative protein levels from Figure 6c . Data are presented as mean ± SD. *p < 0.05, **p < 0.01, and ***p < 0.001 compared with the LV-shCtrl Ctrl group; # p < 0.05, ## p < 0.01, and ### p < 0.001 compared with the LV-shNrf2 Ctrl group; ^ p < 0.05 and ^^ p < 0.01 compared with the corresponding group; & p < 0.05 compared with the LV-shNrf2 Gem group; n.s., not significant.
3.7 BRT suppresses Nrf2 by decreasing Nrf2 mRNA at the transcriptional level in PDAC cells
To elucidate the mechanism through which BRT regulates Nrf2 in PDAC, we assessed the effects of BRT on Nrf2 at the transcriptional level. We first examined Nrf2 mRNA levels through qRT-PCR to determine whether BRT decreased the protein expression of Nrf2 through transcriptional regulation. Treatment with BRT alone, or a combination of BRT and Gem, significantly decreased Nrf2 mRNA in Miapaca-2 and Capan-2 cells, to levels below those in the vehicle control group ( Figure 7a and 7b ). In addition, the combination of BRT and Gem, compared with Gem alone, resulted in significantly lower Nrf2 mRNA levels in Miapaca-2 and Capan-2 cells ( Figure 7a and 7b ). Subsequently, we used MG132, an inhibitor of 26s proteasome activity, to investigate the effect of BRT on Nrf2 protein degradation. Interestingly, treatment with MG-132 alone led to Nrf2 protein accumulation, whereas co-treatment with BRT significantly decreased Nrf2 protein expression ( Figure 7c and 7d ). Additionally, we assessed the stability of Nrf2 by exposing cells to the protein synthesis inhibitor CHX. Combination treatment with CHX and BRT did not alter the half-life of Nrf2 ( Figure 7e and 7f ). Furthermore, we conducted ubiquitination analysis to determine whether BRT might affect the ubiquitination of Nrf2. Unexpectedly, the presence of BRT did not alter Nrf2 ubiquitination ( Figure 7g ). Collectively, these findings suggested that BRT inhibits Nrf2 signaling by decreasing Nrf2 mRNA at the transcriptional level, without directly influencing the stability, degradation, or ubiquitination of Nrf2 protein in Miapaca-2 and Capan-2 cells.
BRT suppresses Nrf2 expression by decreasing Nrf2 mRNA at the transcriptional level in PDAC cells.
(a and b) Relative Nrf2 mRNA levels in cells treated with BRT, Gem, or a combination thereof, as analyzed by qRT-PCR. (c and d) Miapaca-2 and Capan-2 cells were co-treated with MG132 (20 μM) with or without BRT (0.5 μM), and harvested at 3 h and 8 h after treatment for immunoblotting analysis. (e and f) Miapaca-2 and Capan-2 cells were treated with CHX (25 μM) with or without BRT (0.5 μM) for the indicated times, and the cell lysates were analyzed by immunoblotting. (g) Miapaca-2 and Capan-2 cells were treated with BRT (0.5 μM) for the indicated times (0–48 h), and ubiquitin levels were detected by immunoblotting with anti-ubiquitin antibodies. Data are presented as mean ± SD (n = 3). *p < 0.05, **p < 0.01, and ***p < 0.001 compared with the control group. # p < 0.05 compared with the Gem group.
3.8 BRT hinders orthotopic PDAC tumor growth, and sensitizes cells to the anti-tumor effects of Gem, via inhibiting Nrf2 signaling
To assess the Nrf2 dependency of BRT-induced chemosensitization in vivo, we established an orthotopic xenograft mouse model by using Miapaca-2 cells with stable knockdown of either control (shCtrl) or Nrf2 (shNrf2) ( Figure 8a ). In the Miapaca-2-shCtrl group, the tumor size and weight were significantly lower after BRT and Gem combination treatment than Gem-only treatment, but no accompanying body weight loss was observed ( Figure 8b ). However, in the Miapaca-2-shNrf2 group, the combination treatment demonstrated a more pronounced inhibitory effect on tumor size and weight than observed in the Miapaca-2-shCtrl group ( Figure 8c-e ). Moreover, tumor analysis revealed consistently lower cell density (H&E) in the Miapaca-2-shNrf2 group than the Miapaca-2-shCtrl group. IHC staining confirmed a decrease in Nrf2 expression in the Miapaca-2-shNrf2-derived xenografts after BRT treatment. Furthermore, combination treatment with BRT and Gem resulted insignificantly fewer Ki67 positive cells in the Miapaca-2-shNrf2 group than the Miapaca-2-shCtrl group ( Figure 8f and 8g ). Additionally, we observed no abnormalities in the histopathological examination of the liver and kidney tissues ( Supplementary Figure 5a ). Finally, BRT did not show any treatment-related abnormalities in terms of gross anatomy and histological morphology ( Supplementary Figure 5b ). These findings collectively indicated that BRT enhances the sensitivity of Miapaca-2 cell-derived xenografts to Gem by suppressing the activation of Nrf2 signaling.
BRT hinders orthotopic PDAC tumor growth, and sensitizes cells to the anti-tumor effect of Gem, via inhibiting Nrf2 signaling.
(a) Illustration outlining the experiments conducted in the orthotopic PDAC murine model. (b) Measurement of body weights of nude mice every 4 days after cell injection. (d and e) Representative images of tumors and corresponding tumor volumes and weights (n = 7). (f) Representative images of H&E and immunohistochemistry (IHC) staining of resected tumors (scale bar, 50 μm). (g) Statistical graphs of IHC staining of Nrf2 and Ki67. Data are presented as mean ± SD. *p < 0.05, **p < 0.01, and ***p < 0.001 compared with the control group; n.s., not significant; # p < 0.05 compared with the GEM group.
4. DISCUSSION
Chemoresistance poses a major challenge in the effective treatment of cancer [30, 31]. Recent research has suggested that Nrf2 activation may contribute to drug resistance in cancer cells by upregulating the expression of genes involved in drug metabolism and efflux, such as the MRPs MRP1 and MRP5 [32–34]. Moreover, Nrf2 activation has been shown to promote cancer cell survival and proliferation by regulating the expression of genes involved in inhibiting cell apoptosis [35, 36]. However, the relationship between Nrf2 activation and drug resistance is complex and context dependent. Although Nrf2 activation has been implicated in drug resistance in some cancer types, it has also been demonstrated to sensitize cancer cells to certain chemotherapeutic agents in other scenarios [10, 37]. In line with findings from previous studies, Nrf2 has been found to be highly expressed in tumor tissues of patients with PDAC and to be associated with poor prognosis; moreover, Nrf2 depletion significantly enhances the sensitivity of PDAC to Gem [19]. Therefore, Nrf2 might serve as a promising target for PDAC treatment, and combination treatments with Nrf2 inhibitors and chemotherapeutic drugs might provide a useful strategy for improving PDAC treatment outcomes. Further studies are necessary to comprehensively understand the related mechanisms and potential therapeutic implications.
Our research focused on exploring the potential of Nrf2 inhibitors not only as an antitumor agent but also in overcoming the chemosensitivity of PDAC to Gem. Several natural compounds, such as luteolin [38], berberine [39], and ginsenoside Rd [40], have been identified as Nrf2 inhibitors and shown to enhance the chemosensitivity of various cancers to clinical chemotherapeutic agents, thus indicating their potential as chemotherapeutic sensitizers. We previously reported that BD reverses the sensitivity of PDAC cells to Gem by inhibiting Nrf2 signaling [19]. We also observed that BRT exhibits growth inhibitory effects and promotes apoptosis in PDAC cells [18]. Additionally, BRT decreases Nrf2 expression, and sensitizes A549 cells to cisplatin and other chemotherapeutic drugs [17]. In this study, we discovered that BRT markedly enhanced chemosensitivity to Gem in PDAC cells by suppressing Nrf2 activity. These findings further support the potential of Nrf2 inhibitors as a strategy to overcome the chemosensitivity of PDAC to Gem. By targeting Nrf2, compounds such as BRT might increase the effectiveness of chemotherapy in treating PDAC.
We conducted further investigations to assess the ability of BRT to inhibit Nrf2 and sensitize PDAC cells to apoptosis in the presence of Gem-based chemotherapy. BRT significantly inhibited Nrf2 activity in PDAC cells, and silencing of Nrf2 enhanced this inhibitory effect. BRT treatment notably enhanced the anticancer effects of Gem in PDAC. Additionally, BRT reversed the Nrf2 activation induced by the chemotherapeutic drug Gem and the Nrf2 inducer tBHQ in PDAC cells. The regulation of protein levels in cells involves both transcription of genes and degradation of proteins. Previous studies have suggested that BRT selectively decreases Nrf2 protein levels by promoting Nfr2’s ubiquitination and subsequent degradation in A549 lung cancer cells [17]. However, our study demonstrated that the degradation of Nrf2 induced by BRT was not abolished after treatment with the proteasome inhibitor MG-132, and we did not observe increased cellular ubiquitin after BRT treatment. Instead, BRT treatment led to alterations in Nrf2 mRNA levels in Miapaca-2 and Capan-2 cells, thus indicating that BRT regulates Nrf2 expression at the transcriptional level.
In summary, our study offers both in vitro and in vivo evidence supporting BRT as a viable alternative therapy to augment PDAC chemosensitivity to Gem. These findings underscore the potential of BRT as a promising candidate for the development of effective drugs or chemotherapeutic adjuvants for PDAC treatment, particularly in cases with abnormal Nrf2 expression. Nevertheless, further studies are warranted to explore and optimize the use of BRT in patients with PDAC, to fully harness its therapeutic potential and overcome the challenges associated with aberrant Nrf2 expression in PDAC.
